quantstudio 3 qpcr data analysis software Search Results


96
New England Biolabs quantstudio 3
Quantstudio 3, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quantstudio+3+qpcr+data+analysis+software/pmc07188254-159-33-42?v=New+England+Biolabs
Average 96 stars, based on 1 article reviews
quantstudio 3 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

99
Thermo Fisher taq dna polymerase
Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quantstudio+3+qpcr+data+analysis+software/pmc08015054-224-5-10?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
taq dna polymerase - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Thermo Fisher quantstudio 3 realtime pcr system
Quantstudio 3 Realtime Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quantstudio+3+qpcr+data+analysis+software/pm33774798-137-23-28?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
quantstudio 3 realtime pcr system - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Bio-Rad abi quantstudio 3
Abi Quantstudio 3, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quantstudio+3+qpcr+data+analysis+software/pmc07212632-430-21-30?v=Bio-Rad
Average 99 stars, based on 1 article reviews
abi quantstudio 3 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Bio-Rad quantstudio 3
Quantstudio 3, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quantstudio+3+qpcr+data+analysis+software/pm38048369-351-48-43?v=Bio-Rad
Average 99 stars, based on 1 article reviews
quantstudio 3 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Thermo Fisher quantstudio 3
Quantstudio 3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quantstudio+3+qpcr+data+analysis+software/pm27639573-186-6-8?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
quantstudio 3 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Eppendorf AG taqman pcr
Top panel: <t>Taqman</t> <t>RT-PCR</t> results of PDCD6-CCDC127, ACTR2-EML4, PLG-FGG, and β-actin from the benign liver sample. Bottom panel: Taqman RT-PCR results of PDCD6-CCDC127, ACTR2-EML4, PLG-FGG, and β-actin from the HCC sample.
Taqman Pcr, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quantstudio+3+qpcr+data+analysis+software/bio_rxiv__2023__03__16__532991-194-9-11?v=Eppendorf+AG
Average 99 stars, based on 1 article reviews
taqman pcr - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

86
Fisher Scientific quantstudio 3
Top panel: <t>Taqman</t> <t>RT-PCR</t> results of PDCD6-CCDC127, ACTR2-EML4, PLG-FGG, and β-actin from the benign liver sample. Bottom panel: Taqman RT-PCR results of PDCD6-CCDC127, ACTR2-EML4, PLG-FGG, and β-actin from the HCC sample.
Quantstudio 3, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quantstudio+3+qpcr+data+analysis+software/pmc13148645-112-7-9?v=Fisher+Scientific
Average 86 stars, based on 1 article reviews
quantstudio 3 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
GraphPad Software Inc prism 8 windows
Top panel: <t>Taqman</t> <t>RT-PCR</t> results of PDCD6-CCDC127, ACTR2-EML4, PLG-FGG, and β-actin from the benign liver sample. Bottom panel: Taqman RT-PCR results of PDCD6-CCDC127, ACTR2-EML4, PLG-FGG, and β-actin from the HCC sample.
Prism 8 Windows, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quantstudio+3+qpcr+data+analysis+software/pm34932949-283-20-21?v=GraphPad+Software+Inc
Average 90 stars, based on 1 article reviews
prism 8 windows - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Meridian Bioscience quantstudio 3
Top panel: <t>Taqman</t> <t>RT-PCR</t> results of PDCD6-CCDC127, ACTR2-EML4, PLG-FGG, and β-actin from the benign liver sample. Bottom panel: Taqman RT-PCR results of PDCD6-CCDC127, ACTR2-EML4, PLG-FGG, and β-actin from the HCC sample.
Quantstudio 3, supplied by Meridian Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quantstudio+3+qpcr+data+analysis+software/pmc08078664-521-40-47?v=Meridian+Bioscience
Average 90 stars, based on 1 article reviews
quantstudio 3 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Top panel: Taqman RT-PCR results of PDCD6-CCDC127, ACTR2-EML4, PLG-FGG, and β-actin from the benign liver sample. Bottom panel: Taqman RT-PCR results of PDCD6-CCDC127, ACTR2-EML4, PLG-FGG, and β-actin from the HCC sample.

Journal: bioRxiv

Article Title: Long-read single-cell sequencing reveals expressions of hypermutation clusters of isoforms in human liver cancer cells

doi: 10.1101/2023.03.16.532991

Figure Lengend Snippet: Top panel: Taqman RT-PCR results of PDCD6-CCDC127, ACTR2-EML4, PLG-FGG, and β-actin from the benign liver sample. Bottom panel: Taqman RT-PCR results of PDCD6-CCDC127, ACTR2-EML4, PLG-FGG, and β-actin from the HCC sample.

Article Snippet: One microliter of each cDNA sample was used for TaqMan PCR (Eppendorf RealPlex Mastercycler and Applied Biosystems QuantStudio 3) with 50 heating cycles at 94°C for 30 seconds, 61°C for 30 seconds, and 72°C for 30 seconds using the following primer sequences: GAGTGATATCAGACACCGAGC/TTTCTGGGACTCCCTAGACCA and the following TaqMan probe: 5’-/56- FAM/AA GCTCTCT/ZEN/CCAACGGTTGGA/3IABkFQ/-3’ for PDCD6-CCDC127, AGGAAGGTGGTGGTGTGCGA/TTGGGTGAAACTCCACAGCCA and the following TaqMan probe: 5’-/56- FAM/AACGGCACC/ZEN/GGGACAACAAAT/3IABkFQ/-3’ for ACTR2-EML4, CCACAGGAAAGAAGTGTCAGTC/GTTATGGAGTTTTCAACATGGGG and the following TaqMan probe: 5’-/56-FAM/AAGCTCTCT/ZEN/CCAACGGTTGGA/3IABkFQ/-3’ for PLG-FGG in an Eppendorf RealPlex TM thermocycler.

Techniques: Reverse Transcription Polymerase Chain Reaction